Stem-loop sequence mtr-MIR5241b

AccessionMI0018341 (change log)
DescriptionMedicago truncatula miR5241b stem-loop
Gene family MIPF0001290; MIR5241
Literature search

1 open access papers mention mtr-MIR5241b
(1 sentences)

Stem-loop
   auuaa   -au  g    au   ug        u 
5'      agu   ug gcuc  uuu  uucggucg a
        |||   || ||||  |||  |||||||| a
3'      ucg   ac ugag  aag  aagucagu u
   -uaaa   guu  g    --   gu        g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21088246-21088312 [-]
intergenic
Database links

Mature sequence mtr-miR5241b

Accession MIMAT0021236
Sequence

38 - 

ugacugaauggaagagugcau

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).