Stem-loop sequence mtr-MIR5241a

AccessionMI0018340 (change log)
DescriptionMedicago truncatula miR5241a stem-loop
Gene family MIPF0001290; MIR5241
Literature search

1 open access papers mention mtr-MIR5241a
(1 sentences)

Stem-loop
   --g     aa   -    g    au   ug  ug  ug   
5'    caauu  agu aaug gcuc  uuu  uu  gu  ua 
      |||||  ||| |||| ||||  |||  ||  ||  | a
3'    guuag  ucg uuac ugag  aag  aa  ca  gu 
   aga     -a   g    g    --   gu  gu  gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 14773644-14773718 [+]
intergenic
Database links

Mature sequence mtr-miR5241a

Accession MIMAT0021235
Sequence

41 - 

ugacugaauggaagagugcau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).