Stem-loop sequence mtr-MIR5239

AccessionMI0018338 (change log)
DescriptionMedicago truncatula miR5239 stem-loop
Stem-loop
   ---auguuucguuu         g           aauucgaua   au      uag 
5'               gggagaaaa auagaaugugg         gac  gauccg   u
                 ||||||||| |||||||||||         |||  ||||||    
3'               cccucuuuu uaucuugcacc         cug  cuaggu   u
   guccaaaaccccac         a           --gaaucac   --      cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225474.24: 38945-39055 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5239
mtr-MIR7696cAC225474.24: 39293-39378 [+]
mtr-MIR7696aAC225474.24: 39292-39379 [+]
mtr-MIR7696dAC225474.24: 39292-39379 [-]
mtr-MIR7696bAC225474.24: 39289-39381 [-]
mtr-MIR5239AC225474.24: 38945-39055 [-]
Database links

Mature sequence mtr-miR5239

Accession MIMAT0021233
Sequence

11 - 

ugggagaaaagauagaaugug

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).