Stem-loop sequence mtr-MIR2592bk

AccessionMI0018336 (change log)
DescriptionMedicago truncatula miR2592bk stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bk
(2 sentences)

Stem-loop
          u               u      ug               c     a    -ugu        aa     g          -     a 
5' ccaauau cgacuggcauuccca uguucc  ucaaaagauuaaauu uuguu ggcu    uuaaauga  guauu aagugucaag gaaug a
   ||||||| ||||||||||||||| ||||||  ||||||||||||||| ||||| ||||    ||||||||  ||||| |||||||||| ||||| c
3' gguuaua gcuggccguaagggu acaagg  aguuuucuaauuuaa aacaa cuga    aauuuacu  cauaa uuuacaguuu cuuac c
          u               u      ua               c     c    cccu        ac     g          u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 32783558-32783748 [+]
intergenic
Database links

Mature sequence mtr-miR2592bk

Accession MIMAT0021231
Sequence

161 - 

uggaacauugggaaugccggu

 - 181

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).