Stem-loop sequence mtr-MIR2592bj

AccessionMI0018335 (change log)
DescriptionMedicago truncatula miR2592bj stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bj
(2 sentences)

Stem-loop
                  a       c      ug                        c  -au        a      g      -c        g 
5' ccaauauuugaccgg auuccca uguucc  ucaaaagauuaaauucuuguuagg ug   uuaaauga gguauu aagugu  aaggaaug a
   ||||||||||||||| ||||||| ||||||  |||||||||||||||||||||||| ||   |||||||| |||||| ||||||  |||||||| c
3' gguuauaagcuggcc uaagggu acaagg  aguuuucuaauuuaagaacaaucc ac   aauuuacu ccauaa uuuaca  uuucuuac c
                  g       u      ua                        a  ccu        a      g      cu        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 32404919-32405109 [+]
intergenic
Database links

Mature sequence mtr-miR2592bj

Accession MIMAT0021230
Sequence

161 - 

uggaacauugggaaugccggu

 - 181

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).