Stem-loop sequence mtr-MIR2592bi

AccessionMI0018334 (change log)
DescriptionMedicago truncatula miR2592bi stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bi
(2 sentences)

Stem-loop
          u     c         u   c  ug                       -ucc           a      g      -c        a 
5' ccaauau cgacc gcauuccca ugu cc  ucaaaagauuaaauucuuguuag    gguuuaaauga gguauu aagugu  aaggaaug a
   ||||||| ||||| ||||||||| ||| ||  |||||||||||||||||||||||    ||||||||||| |||||| ||||||  |||||||| c
3' gguuaua gcugg cguaagggu aca gg  aguuuucuaauuuaagaacaauc    ccaaauuuacu ccauaa uucaca  uuucuuac c
          u     c         u   a  ua                       caaa           g      a      cu        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225507.19: 185937-186127 [+]
intergenic
Database links

Mature sequence mtr-miR2592bi

Accession MIMAT0021229
Sequence

161 - 

uggaacauugggaaugccggu

 - 181

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).