Stem-loop sequence mtr-MIR2592bg

AccessionMI0018310 (change log)
DescriptionMedicago truncatula miR2592bg stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bg
(2 sentences)

Stem-loop
   u     ca         - g         a      -aag      -      a 
5'  aaauu  uguuaggcu g uuuagauga gguauu    ugucaa ggaaug a
    |||||  ||||||||| | ||||||||| ||||||    |||||| |||||| c
3'  uuuaa  acaauccga c aaaucuacu cuauaa    acgguu cuuuac c
   -     aa         a g         a      guua      g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 31785438-31785544 [+]
intergenic
Database links

Mature sequence mtr-miR2592bg

Accession MIMAT0021204
Sequence

13 - 

aggcugguuuagaugaaggua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).