Stem-loop sequence mtr-MIR2592bf

AccessionMI0018309 (change log)
DescriptionMedicago truncatula miR2592bf stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bf
(2 sentences)

Stem-loop
   a       -c    ----     -     ---    c  --cau     a   uaag              c       a       gc    a  gg    -          c        c      c                a          u             u     c  u     -c  g         a     -          -      a 
5'  uuaacaa  uuga    uuccg ccaga   agau gu     uaguu ggg    gugcauuccaacua aacaauu ucuuacc  ugaa ug  guaa uucaaacuug caaacggc aggacu aagcauuucgcucggc uucauguuuu ccuuugaaaagau aaauu uu uuagg  ug uuuagauga gguau uaagugucaa ggaaug a
    |||||||  ||||    ||||| |||||   |||| ||     ||||| |||    |||||||||||||| ||||||| |||||||  |||| ||  |||| |||||||||| |||||||| |||||| |||||||||||||||| |||||||||| ||||||||||||| ||||| || |||||  || ||||||||| ||||| |||||||||| |||||| c
3'  aauuguu  aacu    ggggu ggucu   ucug ua     aucaa ccu    cacguaagguugau uuguuaa agaaugg  acuu ac  cauu aaguuugaac guuugucg uccuga uuuguaaagugggccg aaguacaaaa ggaaacuuuucua uuuaa aa aaucc  ac aaaucuacu ccaua guucacgguu uuuuac c
   -       ca    uaac     a     cau    u  acaac     -   --ua              a       c       aa    -  ua    u          a        -      u                a          -             -     a  c     aa  g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 30663785-30664214 [-]
intergenic
Database links

Mature sequence mtr-miR2592bf

Accession MIMAT0021203
Sequence

172 - 

aggcugguuuagaugaaggua

 - 192

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).