Stem-loop sequence mtr-MIR2592be

AccessionMI0018308 (change log)
DescriptionMedicago truncatula miR2592be stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592be
(2 sentences)

Stem-loop
   auaaa        ----     -     ---    c  ca  a   -ag  u    u                u          auc    a        -      c             a uc     -    -     a                 u        u      c      g   - g         a      g      -aaa      a 
5'      aaguuuga    uuccg ccaga   agau gu  uu guu   gg aaug gcauuccaacuauaac auugucuuac   ugaa uuggguaa uucaaa uugccaaacgaca g  cucaa cauu cgccc acauucauguuuuuccu ugaaaaga uaaauu uuguua gcu g uuuagauga gguauu aagugu    ggaaug a
        ||||||||    ||||| |||||   |||| ||  || |||   || |||| |||||||||||||||| ||||||||||   |||| |||||||| |||||| ||||||||||||| |  ||||| |||| ||||| ||||||||||||||||| |||||||| |||||| |||||| ||| | ||||||||| |||||| ||||||    |||||| c
3'      uucaaacu    ggggu ggucu   ucug ua  aa caa   cc uuac cguaagguugauguug uaacagaaug   acuu aacccauu aaguuu agcgguuuguugu c  gaguu guaa gcggg uguaaguacaaaaagga acuuuucu auuuaa aacaau cga c aaaucuacu ccauaa uucacg    cuuuac c
   -auug        uaac     a     cau    u  ac  -   gaa  -    c                u          gaa    -        u      a             - cu     c    a     c                 u        u      a      a   a g         a      g      guug      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 22606713-22607142 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592be
mtr-MIR5554cchr7: 22600323-22600427 [-]
mtr-MIR2592bechr7: 22606713-22607142 [+]
Database links

Mature sequence mtr-miR2592be

Accession MIMAT0021202
Sequence

170 - 

aggcugguuuagaugaaggua

 - 190

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).