Stem-loop sequence mtr-MIR2592bd

AccessionMI0018307 (change log)
DescriptionMedicago truncatula miR2592bd stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bd
(2 sentences)

Stem-loop
   -     c                            g             u            u      c         -  g         a      aag   caa  aa 
5'  accug caaacaacaggacucgagcauuucgcuc gcauucauguuuu ccuuugaaaaga uaaauu uuguuaggc ug uuuagauga gguauu   ugu   gg  u
    ||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||| ||||||||| || ||||||||| ||||||   |||   ||   
3'  uggac guuuguuguccugaguucguaaaguggg cguaaguacaaaa ggaaacuuuucu auuuaa aacaauccg ac aaaucuacu ccauaa   acg   cc  a
   u     a                            g             -            u      a         c  a         a      --g   --a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 13077376-13077594 [+]
intergenic
Database links

Mature sequence mtr-miR2592bd

Accession MIMAT0021201
Sequence

75 - 

aggcugguuuagaugaaggua

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).