Stem-loop sequence mtr-MIR2592bc

AccessionMI0018306 (change log)
DescriptionMedicago truncatula miR2592bc stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bc
(2 sentences)

Stem-loop 
                  - g         a     -      u   -      a 
5' aauuuuuguuaggcu g uuuagauga gguau uaagug caa ggaaug a
   ||||||||||||||| | ||||||||| ||||| |||||| ||| |||||| c
3' uuaaaaacaauccga c aaaucuacu cuaua guucac guu cuuuac c
                  a g         a     a      u   g      u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18079525-18079628 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592bc
mtr-MIR2592bcchr6: 18079525-18079628 [-]
mtr-MIR2592schr6: 18079450-18079703 [+]
Database links

Mature sequence mtr-miR2592bc

Accession MIMAT0021200
Sequence

11 -  

aggcugguuuagaugaaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).