Stem-loop sequence mtr-MIR2592bb

AccessionMI0018305 (change log)
DescriptionMedicago truncatula miR2592bb stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bb
(2 sentences)

Stem-loop
   ---ac      aa    cc  g                    c  c    a        -        u c        cag               cu        auguuu    u  g               cg         -u        a      g          -     g 
5'      ggaaug  ugca  uu cagcuacaacaauugucuua cu ugaa ugggguaa uucaaauu g caaacggc   gacucaagcauuucg  cggcauuc      uucc uu aaaagauuaaauucu  uuaggcugg  uuagauga gguauu aagugucaag gaaug a
        ||||||  ||||  || |||||||||||||||||||| || |||| |||||||| |||||||| | ||||||||   |||||||||||||||  ||||||||      |||| || |||||||||||||||  |||||||||  |||||||| |||||| |||||||||| ||||| c
3'      cuuuac  acgu  aa guugauguuguuaacagaau ga acuu aucccauu aaguuuga c guuuguug   cugaguucguaaagc  gcuguaag      aagg aa uuuucuaauuuaaga  aauucgacc  aauuuacu ccauaa uuuacaguuu cuuac c
   aucaa      --    --  g                    a  a    -        u        c a        -ua               ag        gguuac    u  g               au         cu        a      g          u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 1500881-1501235 [+]
intergenic
Database links

Mature sequence mtr-miR2592bb

Accession MIMAT0021199
Sequence

137 - 

aggcugguuuagaugaaggua

 - 157

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).