Stem-loop sequence mtr-MIR2592ba

AccessionMI0018304 (change log)
DescriptionMedicago truncatula miR2592ba stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ba
(2 sentences)

Stem-loop
           c        u                                u            u      c        -c  g        aa     -       g  -      a 
5' aaaccugc aaacaaca gacucgagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguuagg  ug uuuagaug  gguau uaggugu aa ggaaug a
   |||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||  || ||||||||  ||||| ||||||| || |||||| c
3' uuuggacg uuuguugu cugaguucguaaagugggccguaaguacaaaa ggaaacuuuucu auuuaa aacaaucc  ac aaaucugc  ccaua guucacg uu cuuuac c
           u        c                                -            u      a        ac  g        ga     a       g  g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 37815658-37815892 [+]
intergenic
Database links

Mature sequence mtr-miR2592ba

Accession MIMAT0021198
Sequence

77 - 

aggcugguuuagaugaaggua

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).