Stem-loop sequence mtr-MIR2592az

AccessionMI0018303 (change log)
DescriptionMedicago truncatula miR2592az stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592az
(2 sentences)

Stem-loop
   --     c                                          u                   c         -  g         a     -          -      a 
5'   accug caaacaacaggacucgagcauuucgcucggcauucauguuuu ccuuugaaaagauuaaauu uuguuaggc ug uuuagauga gguau uaagugucaa ggaaug a
     ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| || ||||||||| ||||| |||||||||| |||||| c
3'   uggac guuuguuguccugaguucguaaagugggcuguaaguacaaaa ggaaacuuuucuaauuuaa aacaauccg ac aaaucuacu ccaua guucacgguu cuuuac c
   uu     a                                          -                   a         c  g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 11099732-11099964 [+]
intergenic
Database links

Mature sequence mtr-miR2592az

Accession MIMAT0021197
Sequence

75 - 

aggcugguuuagaugaaggua

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).