Stem-loop sequence mtr-MIR2592ay

AccessionMI0018302 (change log)
DescriptionMedicago truncatula miR2592ay stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ay
(2 sentences)

Stem-loop
   aucaa   c    ----     -     ---    c  --cau     a   uaag                               c    a        -                    ag                                u            u      c        -c  g         a     -          -      a 
5'      aag uuga    uuccg ccaga   agau gu     uaguu ggg    gugcauuccaacugcaacaauugucuuaccu ugaa ugggguaa uucaaacuugccaaacggcc  gacucaagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguuagg  ug uuuagauga gguau uaagugucaa ggaaug a
        ||| ||||    ||||| |||||   |||| ||     ||||| |||    ||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||  || ||||||||| ||||| |||||||||| |||||| c
3'      uuc aacu    ggggu ggucu   ucua ua     gucaa ccu    cacguaagguugauguuguuaacagaaugga acuu accccauu aaguuugaacgguuuguugg  cugaguucguaaagugggccguaaguacaaaa ggaaacuuuucu auuuaa aacaaucc  ac aaaucuacu ccaua guucacgguu cuuuac c
   aauug   a    uaac     a     cau    u  acaac     -   --ua                               a    -        u                    -a                                -            u      a        ac  g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 19276056-19276486 [-]
intergenic
Database links

Mature sequence mtr-miR2592ay

Accession MIMAT0021196
Sequence

172 - 

aggcugguuuagaugaaggua

 - 192

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).