Stem-loop sequence mtr-MIR2592ax

AccessionMI0018301 (change log)
DescriptionMedicago truncatula miR2592ax stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ax
(2 sentences)

Stem-loop
   aauuc     a  -c  g         a     -     ga   -      a 
5'      uuguu gg  ug uuuagauga gguau uaagu  caa ggaaug a
        ||||| ||  || ||||||||| ||||| |||||  ||| |||||| c
3'      aacaa cc  ac aaaucuacu ccaua guuca  guu cuuuac c
   -agaa     c  aa  g         a     a     ag   g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 30989449-30989551 [-]
intergenic
Database links

Mature sequence mtr-miR2592ax

Accession MIMAT0021195
Sequence

11 - 

aggcugguuuagaugaaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).