Stem-loop sequence mtr-MIR2592aw

AccessionMI0018300 (change log)
DescriptionMedicago truncatula miR2592aw stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592aw
(2 sentences)

Stem-loop
   --      c      c   a                              u            u      c         -  g        aa     -    c  g  -      a 
5'   accugc aaacaa agg cucgagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguuaggc ug uuuagaug  gguau uagg gu aa ggaaug a
     |||||| |||||| ||| |||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||| || ||||||||  ||||| |||| || || |||||| c
3'   uggacg uuuguu ucc gaguucguaaagugggccguaaguacaaaa ggaaacuuuucu auuuaa aacaauccg ac aaaucugc  ccaua guuc cg uu cuuuac c
   uu      u      a   c                              -            u      a         c  g        aa     a    a  g  g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225526.13: 51752-51984 [+]
intergenic
Database links

Mature sequence mtr-miR2592aw

Accession MIMAT0021194
Sequence

75 - 

aggcugguuuagaugaaggua

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).