Stem-loop sequence mtr-MIR2592av

AccessionMI0018299 (change log)
DescriptionMedicago truncatula miR2592av stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592av
(2 sentences)

Stem-loop
   aauuc          - g         a    -g          -      a 
5'      uuguuaggcu g uuuagauga ggua  uaagugccaa ggaaug a
        |||||||||| | ||||||||| ||||  |||||||||| |||||| c
3'      aacaauccga c aaaucuacu ccau  guucacgguu cuuuac c
   -uaaa          a g         a    aa          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 17514821-17514923 [-]
intergenic
Database links

Mature sequence mtr-miR2592av

Accession MIMAT0021193
Sequence

11 - 

aggcugguuuagaugaaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).