Stem-loop sequence mtr-MIR2592au

AccessionMI0018298 (change log)
DescriptionMedicago truncatula miR2592au stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592au
(2 sentences)

Stem-loop
   auuc          - g         a     -      u   -      a 
5'     uuguuaggcu g uuuagauga gguau uaagug caa ggaaug a
       |||||||||| | ||||||||| ||||| |||||| ||| |||||| c
3'     aacaauccga c aaaucuacu ccaua guucac guu cuuuac c
   uaaa          a g         a     a      u   g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 32690749-32690850 [+]
intergenic
Database links

Mature sequence mtr-miR2592au

Accession MIMAT0021192
Sequence

10 - 

aggcugguuuagaugaaggua

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).