Stem-loop sequence mtr-MIR2592at

AccessionMI0018297 (change log)
DescriptionMedicago truncatula miR2592at stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592at
(2 sentences)

Stem-loop
   a              - g         a     -          -      g 
5'  auuuuuguuaggcu g uuuagauga gguau uaagugucaa ggaaug a
    |||||||||||||| | ||||||||| ||||| |||||||||| |||||| c
3'  uaaaaacaauccga c aaaucuacu ccaua guucacgguu cuuuac c
   -              a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36619674-36619776 [-]
intergenic
Database links

Mature sequence mtr-miR2592at

Accession MIMAT0021191
Sequence

11 - 

aggcugguuuagaugaaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).