Stem-loop sequence mtr-MIR2592as

AccessionMI0018296 (change log)
DescriptionMedicago truncatula miR2592as stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592as
(2 sentences)

Stem-loop
   aucaacaac   a     -     ---    c  ca  a  -uag  u  a  g          g               c        a             a gu      -  a                                 u            u      c          - g         a      -aag      -      a 
5'          uug uuccg ccaga   agau gu  uu gu    gg aa gu cauuccaacu caacaauugucuuac uuugaaug gauaaauucaaac u  caaaca ac ggacucgagcauuucgcucggcauucauguuuu cuuuugaaaaga uaaauu uuguuaggcu g uuuagauga gguauu    ugucaa ggaaug a
            ||| ||||| |||||   |||| ||  || ||    || || || |||||||||| ||||||||||||||| |||||||| ||||||||||||| |  |||||| || ||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||| | ||||||||| ||||||    |||||| |||||| c
3'          aac ggggu ggucu   ucug ua  aa cg    cc uu ca guaagguuga guuguuaauagaaug aaacuuac cuauuuaaguuug a  guuugu ug ccugaguucguaaagcgagcuguaaguacaaaa ggaaacuuuucu auuuaa aacaauccga c aaaucuacu ccauaa    acgguu cuuuac c
   --------u   -     a     cau    u  ac  -  ugaa  -  a  a          g               u        a             g ug      a  a                                 -            u      a          a g         a      guua      g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 37750179-37750596 [-]
intergenic
Database links

Mature sequence mtr-miR2592as

Accession MIMAT0021190
Sequence

171 - 

aggcugguuuagaugaaggua

 - 191

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).