Stem-loop sequence mtr-MIR2592ar

AccessionMI0018295 (change log)
DescriptionMedicago truncatula miR2592ar stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ar
(2 sentences)

Stem-loop
   a       c      - g         a     -          -      g 
5'  auuuuug uaggcu g uuuagauga gguau uaagugucaa ggaaug a
    ||||||| |||||| | ||||||||| ||||| |||||||||| |||||| c
3'  uaaaaac auccga c aaaucuacu ccaua guucacgguu cuuuac c
   -       a      a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 28692981-28693083 [-]
intergenic
Database links

Mature sequence mtr-miR2592ar

Accession MIMAT0021189
Sequence

11 - 

aggcugguuuagaugaaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).