Stem-loop sequence mtr-MIR2592aq

AccessionMI0018294 (change log)
DescriptionMedicago truncatula miR2592aq stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592aq
(2 sentences)

Stem-loop
   -uuaa  uaag                               c    a      -                     c                                  u            u      c          - g         a      -aag      -      a 
5'      gg    gugcauuccaacugcaacaauugucuuaccu ugaa uggggu aauucaaacuugucaaacggc aggacucaagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguuaggcu g uuuagauga gguauu    ugucaa ggaaug a
        ||    ||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||| | ||||||||| ||||||    |||||| |||||| c
3'      cc    cacguaagguugauguuguuaacagaaugga acuu acccca uuaaguuugaacgguuuguug uccugaguuuguaaagugggccguaaguacaaaa ggaaacuuuuuu auuuaa aacaauccga c aaaucuacu ccauaa    acgguu cuuuac u
   gucaa  -uua                               a    -      g                     -                                  -            u      a          a g         a      guua      g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 12319184-12319535 [-]
intergenic
Database links

Mature sequence mtr-miR2592aq

Accession MIMAT0021188
Sequence

136 - 

aggcugguuuagaugaaggua

 - 156

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).