Stem-loop sequence mtr-MIR2592ap

AccessionMI0018293 (change log)
DescriptionMedicago truncatula miR2592ap stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ap
(2 sentences)

Stem-loop
   u   -gguaag                            c  c    a        -        u c        cag               cu               u            u      cuc        - g         a     -          -      a 
5'  uag       gugcauucuaacuacaacaauugucuua cu ugaa ugggguaa uucaaauu g caaacggc   gacucaagcauuucg  cggcauucauguuuu ccuuugaaaaga uaaauu   guuaggcu g uuuagauga gguau uaagugucaa ggaaug a
    |||       |||||||||||||||||||||||||||| || |||| |||||||| |||||||| | ||||||||   |||||||||||||||  ||||||||||||||| |||||||||||| ||||||   |||||||| | ||||||||| ||||| |||||||||| |||||| c
3'  auc       cacguaagguugauguuguuaacagaau ga acuu aucccauu aaguuuga c guuuguug   cugaguucguaaagc  gcuguaaguacaaaa ggaaacuuuucu auuuaa   caauccga c aaaucuacu ccaua guucacgguu cuuuac c
   -   aacuuua                            a  a    -        u        c a        -ua               ag               -            u      caa        a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC146550.40: 50348-50699 [-]
intergenic
AC235665.4: 107244-107595 [+]
intergenic
Database links

Mature sequence mtr-miR2592ap

Accession MIMAT0021187
Sequence

136 - 

aggcugguuuagaugaaggua

 - 156

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).