Stem-loop sequence mtr-MIR2592ao

AccessionMI0018277 (change log)
DescriptionMedicago truncatula miR2592ao stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ao
(2 sentences)

Stem-loop
   ---     u  caa    c   -a         -uuuu            ua         aa     c          ug    a   g 
5'    gugcu gg   aaug uug  guccuguug     caaguuugaauu  ucucauuca  gguaa acaauuguug  guug aau c
      ||||| ||   |||| |||  |||||||||     ||||||||||||  |||||||||  ||||| ||||||||||  |||| |||  
3'    uacga cu   uuau aac  caggacgac     guucaaacuuaa  gggguaggu  ucauu uguuaacaac  caac uua a
   uuc     -  agc    -   cc         uaacc            -c         -c     c          gu    c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 21742145-21742317 [+]
intergenic
Database links

Mature sequence mtr-miR2592ao

Accession MIMAT0021171
Sequence

11 - 

aaaugcuugaguccuguuguu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).