Stem-loop sequence mtr-MIR2592an

AccessionMI0018276 (change log)
DescriptionMedicago truncatula miR2592an stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592an
(2 sentences)

Stem-loop
           c                                         u            u      c         -  g         a     -       g  -      a 
5' aaaccugc aaacaacaggacucgagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguuaggc ug uuuagaugu gguau uaagugu aa ggaaug a
   |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||| || ||||||||| ||||| ||||||| || |||||| c
3' uuuggacg uuuguuguccugaguucguaaagugggccguaaguacaaaa ggaaacuuuucu auuuaa aacaauccg ac aaaucugcg ccaua guucacg uu cuuuac c
           u                                         -            u      a         c  g         a     a       g  g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 28800456-28800690 [-]
intergenic
Database links

Mature sequence mtr-miR2592an

Accession MIMAT0021170
Sequence

205 - 

aaaugcuugaguccuguuguu

 - 225

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).