Stem-loop sequence mtr-MIR2592am

AccessionMI0018275 (change log)
DescriptionMedicago truncatula miR2592am stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592am
(2 sentences)

Stem-loop
   aag               a  -ag             c    c  a                       a        -    gac   c         u      c     c   u   a  a 
5'    ucaaacuugccaaac ac   gacucaagcauuu gccc gc uucauguuuuuccuuugaaaaga uaaauuuu guua   uug uuuagaugg gguauu aagug caa gaa ug u
      ||||||||||||||| ||   ||||||||||||| |||| || ||||||||||||||||||||||| |||||||| ||||   ||| ||||||||| |||||| ||||| ||| ||| || g
3'    aguuugaacgguuug ug   cugaguucguaaa cggg ug aaguacaaaaaggaaacuuuucu auuuaaga caau   gac aaaucuacu ccauaa uucac guu cuu ac u
   uua               c  gua             a    u  c                       a        a    -ac   c         u      -     a   c   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 38243122-38243367 [+]
intergenic
chr4: 38273117-38273362 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592am
mtr-MIR2592lchr4: 38243118-38243371 [-]
mtr-MIR2592amchr4: 38243122-38243367 [+]
mtr-MIR2592amchr4: 38273117-38273362 [+]
Database links

Mature sequence mtr-miR2592am

Accession MIMAT0021169
Sequence

18 - 

caacaggacucaagcauuucgc

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).