Stem-loop sequence mtr-MIR2592al

AccessionMI0018274 (change log)
DescriptionMedicago truncatula miR2592al stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592al
(2 sentences)

Stem-loop
   -   uu  -  u                                     -       a        a       -aa  g             c    cg                  g    uua             g   uuc         u a    c     c       a  a 
5'  uag  gg aa gugcauuccaacuacaacaauugucuuaccuuugaau gggguaa uucaaacu gccaaac   ca gacucaagcauuu gccu  cguucauguuuuuccuuu aaaa   uaaauuuuuguua gcu   uuuagauga g uauu aagug caacgaa ug g
    |||  || || ||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||   || ||||||||||||| ||||  |||||||||||||||||| ||||   ||||||||||||| |||   ||||||||| | |||| ||||| ||||||| || g
3'  auc  cc uu cacguaagguugauguuguuaacagaauggagacuua ccccauu gaguuuga cgguuug   gu cugaguucguaaa cggg  gcaaguauaaaaaggaaa uuuu   auuuaagaacaau cga   aaaucuacu c auaa uucac guugcuu ac u
   a   --  a  c                                     a       -        a       ccg  a             c    ua                  g    cua             a   -cc         u c    -     a       -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 13475564-13475916 [-]
intergenic
Database links

Mature sequence mtr-miR2592al

Accession MIMAT0021168
Sequence

71 - 

caacaggacucaagcauuucgc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).