Stem-loop sequence mtr-MIR2592aj

AccessionMI0018272 (change log)
DescriptionMedicago truncatula miR2592aj stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592aj
(2 sentences)

Stem-loop
   caguu  -  u            c           g  a            aua        ------a             a          c    a          uc          gaa           cag   u c         u      c     ccaccgaa ug   uu 
5'      gg aa gugcauuucaac acaacaauugu uu ccuuugaauggg   aauucaaa       aacaacaggacuc agcauuucgc aagc cuucauguuu  ccuuugaaaa   uaaauuuuugu   gcu g uuuagauga gguauu aagug        u  agg  c
        || || |||||||||||| ||||||||||| || ||||||||||||   ||||||||       ||||||||||||| |||||||||| |||| ||||||||||  ||||||||||   |||||||||||   ||| | ||||||||| |||||| |||||        |  |||   
3'      cc uu cacguaagguug uguuguuaaca aa ggaaacuuaccc   uuaaguuu       uuguuguccugag ucguaaagcg uucg ggaguacaaa  ggaaacuuuu   auuuaagaaca   cga c aaaucuacu ccauaa uucac        a  ucc  a
   -aauc  a  c            a           g  -            -ca        gaacagc             c          -    c          ga          aua           aua   c -         u      -     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 1617098-1617442 [+]
intergenic
Database links

Mature sequence mtr-miR2592aj

Accession MIMAT0021166
Sequence

65 - 

caacaggacucaagcauuucgc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).