Stem-loop sequence mtr-MIR2592ai

AccessionMI0018271 (change log)
DescriptionMedicago truncatula miR2592ai stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ai
(2 sentences)

Stem-loop
   caguu  -  u            c           g  a            aua         c  ca              a          c               uc          gaa           gag   u c         u      c     c  c  a    a 
5'      gg aa gugcauuccaac acaacaauugu uu ccuuugaauggg   aauucaaac ug  aaacaacaggacuc agcauuucgc gagcacuucauguuu  ccuuugaaaa   uaaauuuuugu   gcu g uuuagauga gguauu aagug ca ag auug g
        || || |||||||||||| ||||||||||| || ||||||||||||   ||||||||| ||  |||||||||||||| |||||||||| |||||||||||||||  ||||||||||   |||||||||||   ||| | ||||||||| |||||| ||||| || || |||| g
3'      cc uu cacguaagguug uguuguuaaca aa ggaaacuuaccc   uuaaguuug ac  uuuguuguucugag ucguaaagcg cucguggaguacaaa  ggaaacuuuu   auuuaagaaca   cga c aaaucuacu ccauaa uucac gu uc uaac u
   -aauc  a  c            a           g  -            -ca         a  ag              c          -               ga          aua           aua   c -         u      -     a  -  c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 8318707-8319057 [+]
intergenic
Database links

Mature sequence mtr-miR2592ai

Accession MIMAT0021165
Sequence

71 - 

caacaggacucaagcauuucgc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).