Stem-loop sequence mtr-MIR2592ah

AccessionMI0018270 (change log)
DescriptionMedicago truncatula miR2592ah stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ah
(2 sentences)

Stem-loop
   caguu  -  u            c           g  a c         aua         c  ca              a          c         a     uc          gaa           gag   u c         u      c     ccaccgaa ug   uu 
5'      gg aa gugcauuccaac acaacaauugu uu c uugaauggg   aauucaaac ug  aaacaacaggacuc agcauuucgc aagaaccuc uguuu  ccuuugaaaa   uaaauuuuugu   gcu g uuuagauga gguauu aagug        u  agg  c
        || || |||||||||||| ||||||||||| || | |||||||||   ||||||||| ||  |||||||||||||| |||||||||| ||||||||| |||||  ||||||||||   |||||||||||   ||| | ||||||||| |||||| |||||        |  |||   
3'      cc uu cacguaagguug uguuguuaaca aa g aacuuaccc   uuaaguuug ac  uuuguuguccugag ucguaaagcg uucuuggag acaaa  ggaaacuuuu   auuuaaaaaca   cga c aaaucuacu ccauaa uucac        a  ucc  a
   -aauc  a  c            a           g  a a         -ca         a  ag              c          -         c     ga          aua           aua   c -         u      -     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 27900788-27901137 [-]
intergenic
Database links

Mature sequence mtr-miR2592ah

Accession MIMAT0021164
Sequence

70 - 

caacaggacucaagcauuucgc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).