Stem-loop sequence mtr-MIR2592af

AccessionMI0018268 (change log)
DescriptionMedicago truncatula miR2592af stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592af
(2 sentences)

Stem-loop
       g       -aacag                  c                          a         a   g   u c         u      c     c   c   a  a 
5' aacu gccaaac      gacucaagcauuucgccc gcguucauguuuuuccuuugaaaaga uaaauuuuu uua gcu g uuuagauga gguauu aagug caa gaa ug g
   |||| |||||||      |||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||| ||| | ||||||||| |||||| ||||| ||| ||| || g
3' uuga cgguuug      cugaguucguaaagcggg cgcaaguacaaaaaggaaacuuuucu auuuaagaa aau cga c aaaucuacu ccauaa uucac guu cuu ac u
       a       ccgaua                  u                          a         c   a   c -         u      -     a   c   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 23356390-23356624 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592af
mtr-MIR2670bchr4: 23357485-23357708 [-]
mtr-MIR2592afchr4: 23356390-23356624 [-]
Database links

Mature sequence mtr-miR2592af

Accession MIMAT0021162
Sequence

12 - 

caacaggacucaagcauuucgc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).