Stem-loop sequence mtr-MIR2592ae

AccessionMI0018267 (change log)
DescriptionMedicago truncatula miR2592ae stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ae
(2 sentences)

Stem-loop
   uaguc  -  u                                    -  -     a       a      - -aa  g     a            c  a      c                a          guag   u c         u a    c     ccaacgaaa     uu 
5'      gg aa gugcauuccaacuacaacaauugucuuaccuuugaa ug gguaa uuuaaac ugccaa c   ca gacuc agcauuucgucc gc uucaug uuuuccuuugaaaaga uaaauuuuug    gcu g uuuagauga g uauu aagug         cgagg  c
        || || |||||||||||||||||||||||||||||||||||| || ||||| ||||||| |||||| |   || ||||| |||||||||||| || |||||| |||||||||||||||| ||||||||||    ||| | ||||||||| | |||| |||||         |||||   
3'      cc uu cacguaagguugauguuguuaacagaauggagacuu ac ccauu aaguuug acgguu g   gu uugag ucguaaagcagg cg aaguau aaaaggaaacuuuucu auuuaagaac    cga c aaaucuacu c auaa uucac         guucc  a
   -aauc  a  c                                    u  u     -       a      u ccg  a     c            u  c      a                a          aaua   c -         u c    -     --------a     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36122943-36123293 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592ae
mtr-MIR2592hchr3: 36122992-36123246 [+]
mtr-MIR2592aechr3: 36122943-36123293 [-]
Database links

Mature sequence mtr-miR2592ae

Accession MIMAT0021161
Sequence

69 - 

caacaggacucaagcauuucg

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).