Stem-loop sequence mtr-MIR2592ad

AccessionMI0018266 (change log)
DescriptionMedicago truncatula miR2592ad stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ad
(2 sentences)

Stem-loop
   ---      -uauc       g     a  cc    aaca          -              -  a          c              uu a   c   ccuacu    a  u 
5'    gaugcu     agauguu gaguc ug  guuu    aguuugaauu accccauucaaagg aa acaauuguug aguuggaaggugca  c uuc gua      aacg uc u
      ||||||     ||||||| ||||| ||  ||||    |||||||||| |||||||||||||| || |||||||||| ||||||||||||||  | ||| |||      |||| || u
3'    uuacgg     uuuacga cucag ac  caaa    ucaaacuuaa ugggguaaguuucc uu uguuaacaac ucaaccuuccaugu  g aag cau      uugc ag u
   uac      cccgc       a     g  aa    ccgg          a              a  g          a              uu c   c   ----au    -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 26559227-26559456 [-]
intergenic
Database links

Mature sequence mtr-miR2592ad

Accession MIMAT0021160
Sequence

198 - 

caacaggacucaagcauuucgc

 - 219

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).