Stem-loop sequence mtr-MIR2592ac

AccessionMI0018265 (change log)
DescriptionMedicago truncatula miR2592ac stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ac
(2 sentences)

Stem-loop
   ---      auug   cau     gua   caa    ug ---acuu  -  u  a    a                            -        a                a     -a     g    u                                a               cu  cc        u      c     c   c   a  a 
5'    guuuga    ucc   ccaga   aga   uugu  u       gg aa gu cauu caacuacaacaauugucuuaccuuugaa ugggguaa uucaaacuugccaaac acagg  cucaa cauu cgcccgacauucauguuuuuccuuugaaaaga uaaauuuuuguuagg  ug  uuagauga gguauu aagug caa gaa ug g
      ||||||    |||   |||||   |||   ||||  |       || || || |||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||  ||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||  ||  |||||||| |||||| ||||| ||| ||| || g
3'    caaacu    agg   ggucu   ucu   agca  a       cc uu ca guaa guugauguuguuagcagaauggagacuu accccauu aaguuugaacgguuug uguuc  gaguu guaa gcgggcuguaaguacaaaaaggaaacuuuucu auuuaagaacaaucc  ac  aaucuacu ccauaa uucac guu cuu ac u
   uuu      ---a   --c     ---   ---    gu auccauc  a  c  c    g                            u        -                c     ag     -    -                                a               -u  ca        u      c     a   c   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 4044329-4044748 [-]
intergenic
Database links

Mature sequence mtr-miR2592ac

Accession MIMAT0021159
Sequence

107 - 

caacaggacucaagcauuucgc

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).