Stem-loop sequence mtr-MIR2592ab

AccessionMI0018264 (change log)
DescriptionMedicago truncatula miR2592ab stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592ab
(2 sentences)

Stem-loop
   -                      g  c   a            a            u          u c      c         -  g         a      -aag      -      a 
5'  aauucaaaccugccaaacaaca ga uca gcauuucgcucg cauucauguuuu ccuuugaaaa a uaaauu uuguuaggu ug uuuagauga gguauu    ugucaa ggaaug a
    |||||||||||||||||||||| || ||| |||||||||||| |||||||||||| |||||||||| | |||||| ||||||||| || ||||||||| ||||||    |||||| |||||| c
3'  uuaaguuuggacgguuuguugu cu agu cguaaagcgggc guaaguacaaaa ggaaacuuuu u auuuaa aacaaucca ac aaaucuauu ccauaa    acgguu cuuuac c
   u                      a  c   g            c            -          c u      a         c  g         a      guua      a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 28276328-28276573 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592ab
mtr-MIR2592abchr1: 28276328-28276573 [-]
mtr-MIR2592achr1: 28276324-28276577 [+]
Database links

Mature sequence mtr-miR2592ab

Accession MIMAT0021158
Sequence

18 - 

caacaggacucaagcauuucgc

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).