Stem-loop sequence mtr-MIR2592y

AccessionMI0018261 (change log)
DescriptionMedicago truncatula miR2592y stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592y
(2 sentences)

   a                        -               cu            u           uau   - g         a     -         -a      a 
5'  aacaacaggacucaagcauuucgc aagcaccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga gguau uaaguguca  ggauug a
    |||||||||||||||||||||||| |||||||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| ||||| |||||||||  |||||| c
3'  uuguuguccugaguucguaaagcg uuuguggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccaua guucacggu  cuuaac c
   -                        g               ag            u           cuc   a g         a     a         gg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 14892073-14892290 [-]
Database links

Mature sequence mtr-miR2592y

Accession MIMAT0021155

4 - 


 - 25

Get sequence
Evidence experimental; Illumina [1]


PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).