Stem-loop sequence mtr-MIR2592u

AccessionMI0018257 (change log)
DescriptionMedicago truncatula miR2592u stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592u
(2 sentences)

Stem-loop
   guca                        -               cu            u           uau   - g         a     -         -a      a 
5'     aacaacaggacucaagcauuucgc aagcaccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga gguau uaaguguca  ggauug a
       |||||||||||||||||||||||| |||||||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| ||||| |||||||||  |||||| c
3'     uuguuguccugaguucguaaagcg uuuguggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccaua guucacggu  cuuaac c
   ----                        g               ag            u           cuc   a g         a     a         gg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 4195504-4195724 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592u
mtr-MIR2592uchr2: 4195504-4195724 [-]
mtr-MIR2592bchr2: 4195488-4195736 [+]
Database links

Mature sequence mtr-miR2592u

Accession MIMAT0021151
Sequence

7 - 

caacaggacucaagcauuucgc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).