Stem-loop sequence mtr-MIR2592t

AccessionMI0018255 (change log)
DescriptionMedicago truncatula miR2592t stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592t
(2 sentences)

Stem-loop
   -     c   c                     -               cu            u           uau   - g         a     -         -a      a 
5'  cuugu aaa aacaggacucaagcauuucgc aagcaccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga gguau uaaguguca  ggauug a
    ||||| ||| ||||||||||||||||||||| |||||||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| ||||| |||||||||  |||||| c
3'  ggacg uuu uuguccugaguucguaaagcg uuuguggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccaua guucacggu  cuuaac c
   u     u   a                     g               ag            u           cuc   a g         a     a         gg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 35460547-35460778 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592t
mtr-MIR2629hchr3: 35459621-35459714 [-]
mtr-MIR2592gchr3: 35460535-35460792 [-]
mtr-MIR2592tchr3: 35460547-35460778 [+]
Database links

Mature sequence mtr-miR2592t

Accession MIMAT0021149
Sequence

10 - 

caacaggacucaagcauuucgc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).