Stem-loop sequence mtr-MIR5205d

AccessionMI0018243 (change log)
DescriptionMedicago truncatula miR5205d stem-loop
Literature search

1 open access papers mention mtr-MIR5205d
(1 sentences)

Stem-loop
   ---aaag g        uu          gu    a 
5'        g ucuuauaa  agggacggag  agua u
          | ||||||||  ||||||||||  |||| a
3'        u aggauauu  ucccugccuc  ucau u
   cauuuga g        uu          uc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 45033879-45033950 [+]
intergenic
Database links

Mature sequence mtr-miR5205d

Accession MIMAT0021136
Sequence

8 - 

cuuauaauuagggacggagguagu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).