Stem-loop sequence mtr-MIR5205c

AccessionMI0018242 (change log)
DescriptionMedicago truncatula miR5205c stem-loop
Literature search

1 open access papers mention mtr-MIR5205c
(1 sentences)

Stem-loop
   -----aaaa    -cu      u           uaguauugauu          -u   gaucug    -  -u  cau   u 
5'          gggu   uauaau agggacggagg           ggacggcuac  gau      aaug ca  ga   gaa a
            ||||   |||||| |||||||||||           ||||||||||  |||      |||| ||  ||   ||| c
3'          cccg   guauua uuucuguuucu           uuugccggug  cua      uuac gu  cu   uuu a
   cucccuuug    auu      u           ----------c          uc   -aacaa    a  uu  -uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 8755342-8755491 [-]
intergenic
Database links

Mature sequence mtr-miR5205c

Accession MIMAT0021135
Sequence

9 - 

cuuauaauuagggacggagguagu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).