Stem-loop sequence mtr-MIR5205b

AccessionMI0018241 (change log)
DescriptionMedicago truncatula miR5205b stem-loop
Gene family MIPF0000344; MIR818
Literature search

1 open access papers mention mtr-MIR5205b
(1 sentences)

Stem-loop
   aaaa   --    a   -u     acggagg          aaa 
5'     ggg  ucuu uaa  uaggg       gaguacuuca   g
       |||  |||| |||  |||||       ||||||||||    
3'     ccc  agaa auu  auccc       cucaugaagu   a
   --aa   au    a   uc     aucauua          cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 8930370-8930454 [-]
intergenic
Database links

Mature sequence mtr-miR5205b

Accession MIMAT0021134
Sequence

9 - 

cuuauaauuagggacggagggagu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).