Dead miRNA entry

miRNA accession:
MI0018237
miRNA ID:
bdi-MIR396f
Forward to:
MI0018125
Comment:
Two previously annotated MIR396 (b and f) entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR396f

AccessionMI0018237 (change log)
DescriptionBrachypodium distachyon miR396f stem-loop
Stem-loop
         c    g    c      ca                g   uc       uguucuccucugaauugugucgugga 
5' gagaug gcgg caug uuucca  ggcuuucuugaacugu aac  guggggg                          a
   |||||| |||| |||| ||||||  |||||||||||||||| |||  |||||||                          u
3' uucuac cgcc guac aaaggu  ccgaaagaacuuggua uug  cgccucu                          u
         -    -    c      ac                g   uc       cuagcugccuauuucuuguucgggcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR396f

Accession MIMAT0020762
Sequence

20 - 

uuccacaggcuuucuugaacu

 - 40

Get sequence
Evidence experimental;

References

1