Dead miRNA entry

miRNA accession:
MI0018217
miRNA ID:
bdi-MIR390b
Forward to:
MI0018085
Comment:
Two previously annotated MIR390 entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR390b

AccessionMI0018217 (change log)
DescriptionBrachypodium distachyon miR390b stem-loop
Stem-loop
         ---    aau  u  a         g         cuagguucacugcaaccaacaagagaaccggccaucgauauauacauauaua 
5' gguaag   gaac   cc ug agcucagga ggauagcgc                                                    u
   ||||||   ||||   || || ||||||||| |||||||||                                                    g
3' ccauuc   cuug   gg ac ucgaguccu ucuaucgcg                                                    u
         uug    cuu  c  c         a         aagccugcuugucuagcugccuuggucguucucuagcuagccagcuagcucc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR390b

Accession MIMAT0020742
Sequence

19 - 

gaagcucaggagggauagcgc

 - 39

Get sequence
Evidence experimental;

References

1