Stem-loop sequence mml-mir-663-5

Accession MI0018205
Description Macaca mulatta miR-663-5 stem-loop
Gene family MIPF0000462; mir-663
Stem-loop
cc uu   c   -     -c  g   - ug     --     c   ug 
  g  cgg guc ccagg  gg gcg c  cggga  ccgcc ucg  u
  |  ||| ||| |||||  || ||| |  |||||  ||||| |||   
  c  gcc cgg ggucc  uu ugc g  gcccu  ggugg ggu  c
-- cg   -   u     uu  g   c gu     ag     c   gu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099214147902: 186-275 [+]
intergenic
Database links

Mature sequence mml-miR-663

Accession MIMAT0006502
Sequence

15 - 

aggcggggcgcugcgggaccgc

 - 36

Get sequence
Evidence by similarity; MI0003672
Predicted targets

References

1