Stem-loop sequence mml-mir-371-2

Accession MI0018199
Description Macaca mulatta miR-371-2 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
               cu    g        cug u u 
5' guggcacucaaa  gugg ggcacuuu   c c c
   ||||||||||||  |||| ||||||||   | |  
3' cauugugaguuu  uacc ccgugaaa   g g u
               ug    g        aaa u g 
Get sequence
Deep sequencing
90 reads, 51.4 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-371-5p

Accession MIMAT0006296
Sequence

6 - 

acucaaacugugggggcacu

 - 25

Get sequence
Evidence by similarity; MI0000779
Predicted targets

Mature sequence mml-miR-371-3p

Accession MIMAT0006297
Sequence

45 - 

aagugccgccauguuuugagugu

 - 67

Get sequence
Evidence by similarity; MI0000779
Predicted targets

References

1