Stem-loop sequence mml-mir-371-2

Accession MI0018199
Description Macaca mulatta miR-371-2 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
            cu    g        cug u u 
guggcacucaaa  gugg ggcacuuu   c c c
||||||||||||  |||| ||||||||   | |  
cauugugaguuu  uacc ccgugaaa   g g u
            ug    g        aaa u g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59898391-59898460 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-371-2
mml-mir-371-1 19: 59895652-59895721 [+]
mml-mir-371-2 19: 59898391-59898460 [+]
mml-mir-372 19: 59898600-59898666 [+]
mml-mir-373 19: 59899307-59899375 [+]
Database links

Mature sequence mml-miR-371-5p

Accession MIMAT0006296
Sequence

6 - 

acucaaacugugggggcacu

 - 25

Get sequence
Evidence by similarity; MI0000779
Predicted targets

Mature sequence mml-miR-371-3p

Accession MIMAT0006297
Sequence

45 - 

aagugccgccauguuuugagugu

 - 67

Get sequence
Evidence by similarity; MI0000779
Predicted targets

References

1