Stem-loop sequence ssp-MIR396

AccessionMI0018195 (change log)
DescriptionSaccharum sp. miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ssp-MIR396
(1 sentences)

Stem-loop
               c             -  -aa -   -  c  c    a 
5' uuccacagcuuu uugaacugcaucu cu   g agg ag ag ucga g
   |||||||||||| ||||||||||||| ||   | ||| || || ||||  
3' agggugucgaaa aacuugacgugga ga   c ucc uc uc agcu c
               u             c  gua g   a  -  a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssp-miR396

Accession MIMAT0020295
Sequence

1 - 

uuccacagcuuucuugaacug

 - 21

Get sequence
Evidence not experimental

References

1
PMID:21092324 "Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane" Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ, Vincentz M, Nogueira FT BMC Plant Biol. 10:260(2010).