Stem-loop sequence ssp-MIR156

AccessionMI0018191 (change log)
DescriptionSaccharum sp. miR156 stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aggcugacagaagagagugagcacacauggugccuuucuugcaugaugaacgaucgagagguucaugcucgaagcuaugcgugcucacuucucucucugucagccguuagaacucucucucgaucgcacccucccucgaucucucuuucguucucugucaaucucucccauggugauauuuauuugcuugucugcguguucucuuuccuaagcacagacacgaccaguucacggugccuuagguguuuuuuugcacuuugccugaagagaggaaggcaag              -u   -a    u      -             a      gguu     n    a 
5'                                                                                                                                                                                                                                                                                         ggggagauggguuu  uga  gguu gacaga agagagugagcac cacggu    ucuua caug g
                                                                                                                                                                                                                                                                                           ||||||||||||||  |||  |||| |||||| ||||||||||||| ||||||    ||||| |||| u
3'                                                                                                                                                                                                                                                                                         ucucucuacccgga  acu  ccga cugucu ucucucacucgug gugucg    agggu guac g
   ----------------------------------------------------------------------------------------------------------------------------------------------------uauccuccuccuauaugggcuguaacucuagguguacaauuaguauaaaucgaagauauuaguauauuaacguguucucuagcuagacacagguucunugaaguucccgagcuuguauaucggcgccunugg              cu   ca    -      a             c      ----     c    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssp-miR156

Accession MIMAT0020291
Sequence

304 - 

ugacagaagagagugagcaca

 - 324

Get sequence
Evidence not experimental

References

1
PMID:21092324 "Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane" Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ, Vincentz M, Nogueira FT BMC Plant Biol. 10:260(2010).