Stem-loop sequence ssp-MIR444b

AccessionMI0018186 (change log)
DescriptionSaccharum sp. miR444b stem-loop
Gene family MIPF0000402; MIR444
Stem-loop
        a        g        u                   ----a   aau 
5' caagc ugaggcag aacugcau acuugcaagaaagucacaa     auc   u
   ||||| |||||||| |||||||| |||||||||||||||||||     |||    
3' guucg acuccguu uugacgug ugaacguucuuucgguguu     uag   g
        a        g        u                   cauac   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssp-miR444b.1

Accession MIMAT0020284
Previous IDsssp-miR444b*
Sequence

64 - 

uuguggcuuucuugcaaguug

 - 84

Get sequence
Evidence not experimental

Mature sequence ssp-miR444b.2

Accession MIMAT0020285
Previous IDsssp-miR444b
Sequence

85 - 

ugcaguuguugccucaagcuu

 - 105

Get sequence
Evidence not experimental

References

1
PMID:21092324 "Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane" Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ, Vincentz M, Nogueira FT BMC Plant Biol. 10:260(2010).