|
miRBase |
|
Stem-loop sequence hsa-mir-5187 |
|||||
| Accession | MI0018166 | ||||
| Description | Homo sapiens miR-5187 stem-loop | ||||
| Stem-loop |
ga agg u u - ga c au cua g ggga gag ggauu aguggag agga g ||| | |||| ||| ||||| ||||||| |||| ggu c uccu uuc ccuaa ucaccuc uuuu c -- gga - u u -g - cg |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence hsa-miR-5187-5p |
|
| Accession | MIMAT0021117 |
| Sequence |
10 - ugggaugagggauugaagugga - 31 |
| Deep sequencing | 98 reads, 15 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
Mature sequence hsa-miR-5187-3p |
|
| Accession | MIMAT0021118 |
| Sequence |
52 - acugaauccucuuuuccucag - 72 |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|
| 2 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|